The History of Zero - 1561 Words

â€Å"From placeholder to the driver of calculus, zero has crossed the greatest minds and most diverse borders since it was born many centuries ago. Today, zero is perhaps the most pervasive global symbol known. In the story of zero, something can be made out of nothing† (Downey 1, The history of zero). Zero came from the Latin word zehirum, which comes from the Arbid sife translated from the Hindu sunya meaning empty. The first time zero was used in English language was in 1598. One of the many debates by mathematicians, even in our perspectives classroom is if zero was invented or discovered. â€Å"Zero’s path through time and thought has been as full of intrigue, disguise and mistaken identity as were the career of the traveller who first brought it to the west† (Kaplan, The Nothing That Is: A Natural History of Zero). Other debates by mathematicians are if zero is a placeholder or if it is a real number. The way our world functions today is based on understan ding and working with zero. Without zero there would be no calculus, accounting or computers. We live in a world that uses these items every single minute of every day. â€Å" The story of zero is the story of an idea that has aroused the imagination of great minds across the globe† (Downey 1, The history of zero). Understanding zero and what it is today, we have to look back at the history of zeros origins and how it traveled through time. In ancient Egyptian mathematics, it was used to measure time, counting money, calculatingShow MoreRelatedThe History of Zero: Indian and Mayan Cultures726 Words   |  3 PagesZero is usually recognized today as being originated in two geographically separated cultures: the Maya and Indian. If zero was a place-holder symbol, then such a zero was present in the Babylonian positional number system before the first recorded occurrence of the Indian zero. If zero was represented by an empty space within a well-defined positional number system, such a zero was present in Chinese mathematics a few centuries before the beginning of the Common Era. The absence of a symbol forRead MoreThe Columbian Exchange Statistics782 Words   |  4 PagesIreland in 1491: zero Tomatoes in all of Italy in 1491: zero Peppers in all of Spain in 1491: zero Strawberries in all of England in 1491: zero Cocoa beans in all of Switzerland in 1491: zero Peanuts in all of West Africa in 1491: zero Cassava roots in all of the Congo in 1491: zero Ears of corn in all of Europe in 1491: zero Horses on the Great Plains of North America in 1491: zero Coffee plants in South America in 1491: zero Cane sugar plants in the Caribbean in 1491: zero Fields of bluegrassRead More Holes Essay504 Words   |  3 Pages Stanley Yelnats has a history of being in the wrong place and the wrong time. He was even wrongly accused of stealing a pair of old sneakers that was owned by a baseball player. He was sent to a juvenile correction center, Camp Green Lake. On Camp Green Lake there is nothing green and no lake, there are also no metal bars, electric fences, and no guard towers, all there is are a few cabins and tents in the middle of nowhere. If the campers tried to run they would be â€Å"buzzard food†. Each day everyRead MoreThe Occupation And Abuse Of National And Female Bodies1473 Words   |  6 PagesFirdaus engages with the separation of these facets throughout Woman at Point Zero. She explains how prostitution is an exchange where she offers up her â€Å"dead body† and keeps her â€Å"heart and soul† (Sadaawi â€Å"Point Zero† 116). However these is a split between body and soul that is irredeemable. She believes through love she could unite her body and soul and claims that love will help her â€Å"to feel whole† (Sadaawi â€Å"Point Zero† 116). However due to the exploitative quality in sex between a man and a womanRead MoreAgrument on Zero-Tolerance Policy1056 Words   |  5 PagesZero Tolerance for College Students Gladwell stated in, â€Å"No Mercy† (2006), â€Å"this is the age of zero tolerance.† Zero tolerance policies, which are regulations for specific issues such as weapons, drugs, cheating and alcohol, are adopted by many schools and workplaces today. According to a government study, more than three quarters of the schools in America use zero policy to restrict students from misconduct. However, statistics show that there is no evidence proving that bad behaviors get deterredRead MoreEssay about We Cannot Have A Successful Society If Zero Is Not Involved1311 Words   |  6 PagesWe Cannot Have A Successful Society If Zero Is Not Involved INTRODUCTION: The number zero may be thought to have very little importance, but it is actually of great value. Zero is the number that precedes 1 and follows –1 so it may represent the value of nothing. Zero is also important in holding a place value. It is a composite integer that is neither odd or even, though that fact can be debated. Zero is involved in many areas of study including modular arithmetic, computer sciences, and physicsRead MoreUses And Accuracy Of Newton s Method1743 Words   |  7 Pagesdiscoveries in both math and science. From gravity to calculus, Newton made many fundamental breakthroughs that have shaped thought for centuries and are still in use today. For this reason, Newton has always been one of the most interesting characters in history for me and thus is why I found such great interest in his theories and being able to explore them further. However, though he had countless monumental breakthroughs, he also had other theories that are not as well known, which i nterested me even moreRead MoreThe Developement of Mathematics Essay1167 Words   |  5 PagesAlthough the history of numbers is rather unknown and unlooked upon compared to the history of other subjects; we should learn of the development of numbers, from the basic number sense that some animals also possess to all the different numbers we have today. After all, it is because of numbers that we have progressed so far in science and it is because of science that we have all the wonderful inventions of today. From the far beginning, before counting, man only had a rudimentary â€Å"number sense†Read MoreGlobalization Will Provide a World Free of War Essay1000 Words   |  4 Pages In the history of civilizations the contest for human interaction has been war. Despite how advanced our world is today with global telecommunications, the ability to travel to space, and nano technology, war is still a part of every day life for a large part of the global population, but in this newly connected global marketplace, peace has or will have even more value than war. Globalization is a connected marketplace of economics, education and travel. It is now just as easy to communicateRead MoreMarketing Strategy of Coke Zero736 Words   |  3 Pagesleading manufacturer, marketer and distributor of non alcoholic beverage. Coca-Cola Zero has been one of the most successful product launches in our history. In 2009, we sold more than 600 million cases globally. As of September 2010, Coca-Cola Zero is available in more than 130 countries. Brand Positioning The soft drinks market is dominated by 3 household Coca Cola, PepsiCo and Dr Pepper Snapple. Coke Zero is successful because it was carried to new category – sugar free coke and be first

William Faulkner s Literary Accomplishments - 1753 Words

William Faulkner was a powerful writer whose highly anthologized works bear the image of the Southern Gothic tradition and the weight of more than half a century of literary analysis and criticism. Despite a vast amount of intense and perhaps belated scrutiny directed at Faulkner s literary accomplishments, the author himself had a vision and scope not to be outdone by his commentators. Between 1929 and 1936, Faulkner published novels with characters ranging from children, thinkers, the insane, the law-breaking, and even those beyond the grave serving as vehicles for themes of time, sex, race, childhood, retribution, family life, Southern Life, and cultural change. In the construction of these stories, Faulkner employed an unmistakeably flowery, intense, and suspenseful narration, often from many different perspectives. He even constructed – in the truer sense of the word – a whole southern American-themed world (which he named â€Å"Jefferson and Yoknapatawpha County †) for his stories and acted through his writing as his world s historian. In this essay I turn to part of that history as told by Faulkner in two of his most famous works and short stories, â€Å"Barn Burning† and â€Å"A Rose For Emily†, with the purpose of realizing the thematic similarities between the two. Conflict between the protagonists convictions and reality itself is the driving force behind character action and its resolution in both â€Å"A Rose For Emily† and â€Å"Barn Burning†. The unwillingness of theShow MoreRelatedSex As A Political Condition1592 Words   |  7 Pagesspirit and inelegant in ethos, equal parts hilarious, offensive, and insightful.† Flores, a professor and published author, has had a successful career. Born and raised in El Paso, TX, he graduated UTEP with a master’s degree in English in the 1970’s. Shortly afterwards, he started working at LCC (Laredo Community College) as an English Professor. He then decided to â€Å"teach a course on Black and Chicano literature that led to a National Endowment for the Humanities Fellowship at Dartmouth CollegeRead MoreModernist Elements in the Hollow Men7051 Words   |  29 Pagesthis complexity, which is at the heart of modernism as a literary movement, that makes of Eliot’s poetry very typically modernist. As Ezra Pound once famously stated, Eliot truly did â€Å"modernize himself†. Although his poetry was subject to important transformations over the course of his career, all of it is characterized by many unifying aspects typical of modernism. It employs characters who fit the modern man as described by Fitzgerald, Faulkner and others of t he poet’s contemporaries. It is markedRead MoreKhasak14018 Words   |  57 PagesMonday, 26 October 2009 Preface This dissertation titled ART AS A RENDEZVOUS OF MYTH AND MIND: A PSYCHOANALYTIC AND MYTHOLOGICAL ANALYSIS OF O V VIJAYAN’S THE LEGENDS OF KHASAK explores how the judicious selection and use of literary theory can account for the universal appeal of The Legends of Khasak, a belated self translated rendering of a famous regional work in Malayalam, Khasakkinte Ithihasam authored by the eminent writer O V Vijayan, and thus assert its artistic value. Divided into fourRead MoreThe Ballad of the Sad Cafe46714 Words   |  187 PagesThe Ballad of the Sad Cafà © and Other Stories by Carson McCullers Back Cover: When she was only twenty-three her first novel, The Heart Is A Lonely Hunter, created a literary sensation. She is very special, one of America s superlative writers who conjures up a vision of existence as terrible as it is real, who takes us on shattering voyages into the depths of the spiritual isolation that underlies the human condition. A grotesque human triangle in a primitive Southern town. . . A young

Perspective And Explaining Differences †Myassignmenthelp.Com

Question: Discuss About The Perspective And Explaining Differences? Answer: Over the years, various theories have come up that have implemented the theoretical concept of change. According to (Cameron, Making sense of change management: A complete guide to the models, tools and techniques of organizational change, 2015) organisational change is a process that can be implemented in order to bring about success. In most cases, it has been seen that change in the policy or mode of work has helped in improving the falling standards of an organisation. The ontology of change is an example of the ways by which these changes can be implemented in the organisation. However, in order to implement the changes, it is necessary that the people working in the organisation embrace the changes. This is an important factor that needs to be considered by the managers while planning for change in an organisational context (Booth S. , 2015) However,(Waddell, 2013) stated that the ability to control, identify and implement the requirements for the success of an organisation is considered as change management. The first ontology related to change management states that the ability of the managers to identify the policies or procedure that prevents the success of an organisation can help in implementing necessary changes. The fact that changes in the perspective of an organisation remain constant is an example of the ways by which employees need to embrace the changes. In this regard, the role of the managers is important in order to motivate the employees and engage in bringing about changes through leadership. In this regard, the two definitions of change can be analysed clearly in order to identify the similarity of thoughts between the two scholars. Theories can be related in order to identify the implementation method used for managing change in the organisations. The common links that can be revealed by analysing the definitions include the resistance to change by employees. (Higgs, 2014) stated that the resistance shown by the employees in terms of accepting changes in the organisation indicates that employees fear the job security. This can be related to the second ontology or worldview that mainly states that with the evolution of time, organisations tend to implement changes that are suited for the particular situation. For example, in the modern world, most organisations like to bring about changes in terms of improving technically. The use of technology in the organisation can help in reducing the manual labour provided by the employees. Thus, in this regard, the employees without technical knowledge or expertise can suffer from employment issues. In this regard, the theories suggested by Lewin and Kotter can be applied. Lewin stated a three-stage change management system that focused on planning the change, executing the change and implementing the change in the organisation. On the other hand, Kotter suggested an eight-step model that involves a systematic approach to change. The implementation of these theories in an organisation can help in reducing the resistance from the employees (Farkas, 2016). The definitions also suggest that in order to gain success, every organisation need to implement changes. This can be termed as a long-term goal of an organisation. In order to implement changes, it is necessary that the employees working in the organisation share the goals of the managers. About the organisation Truelocal is an organisation that is based in Sydney, having smaller branches in Melbourne and Brisbane. It has over 150 staffs, an augmentation of approximately 50 per cent over the period of past two years. It was originated in 2005 by NDM as an element of an intensifying operation of the online websites; information about the weather and online sport; search engine for shopping comparison and web based recruitment. As the world has reallocated itself into the age of digital info, the demand for consumers of the online media as means of sourcing information significantly augmented. The demand for the printed media diminished, putting much pressure on the companies of a newspaper for expanding to producing news along with information online in the digital design. This took into account News Corporation that diminished the operations of its newspaper and augmented its digital extension. Describing changes There was much requirement for Truelocal to bring into line its culture, structure and values with the parent corporation for meeting the goals of strategic growth not long after its establishment. According to (Goetsch Davis, 2014) , experts make use of three primary sets of change within their approach, technical design, political allotment and issues of the cultural mix. One of these issues became a pressing problem at any point of time, initiating the changes. In the case of Truelocal there have been a number of alterations evolving and at this point of time, it has been the culture issue. NDM has been expanding in size since its institution in the year 2006 with a number of obtained operations of the website; each has been operating as the separate unit of business with the sustainability of the IT, Finance, Commercial Operations along with the support services that are being offered by the parent company (NDM). A decision was made for aligning the organisation in terms of the operations, strategy and culture so that it could ponder on the factor of performance and innovation for attaining the goals of becoming the number one contributor of Australias online information(Hornstein, 2015). Hence, because of this, NDM redesigned the structure of its organisation as most of the other units of business along with Truelocal merged together into one location. After the relocation took place, Truelocal began gratifying the structure of the company that is being led by the new management team along with the CEO. Since then, it has been under the regular change to attain the goals that it has for its continual growth. Performance gap can be stated as the desire in moving from one less preferred state to that of another. This can be witnessed by the augmented performance after the change has taken place along with the alteration of culture has been implemented (Hechanova, 2013). Changes related to fundamental that took place from the shift from existing bureaucratic and vertical formation to a horizontal structure and modification in the dedicated execution of the divisions generating a culture of a corporate environment that has been customer focused. The accessible culture was deemed a casual attitude towards the requirement of dress, breaks along with informal expression of communication(Hayes J. , 2016). The changes implemented in the organisations need to be executed by the change agents. These agents are the managers of the company. The managers involve the employees by using motivational techniques necessary for implementing these changes. On some occasions, it is seen that the employees are motivated, however, there are also times when the changes made remains out of expertise for the employees. This may result in the loss of job for the employees due to lack of adaptability. Relating change definitions The definitions related to change can help Truelocal to understand the prospect of change. The organisation deals with the online business, it is important for the company to embrace the changes. This is mainly because of the fact that in the modern, the use of the internet is a common factor for many people. With the use of the internet, people around the world search for information, conduct shopping, read the news. Truelocal provides such facilities to the people. Hence, continuous changes in the field of technology are required for the organisation. Adoption of backdated technology can provide a competitive disadvantage for the company. Thus, in order to bring about success in the organisation, it is necessary that the changes be maintained and embraced as per the requirement of the market. Conducting a SWOT analysis After the analysing the changes that occurred in Truelocal, a SWOT analysis of the changes can be undertaken. According to Olins (2017), SWOT analysis is conducted in order to identify the internal potentials of an organisation. In this case, the SWOT analysis is based on the operations that the company undertakes and the recent exploits of the company. Strengths High prowess in the technical field Merging with a reputed company Relocating to a proper place of business Weakness Poor structure Cultural factors Gap in performance Opportunities Expansion into global business Motivation to attain organisational goals Recognition in the local market Threats Competitor threat Continuous updates in technologies Employee turnover Table: SWOT analysis After analysing the table, it can be said that the strength of the organisation lies in the fact that it merged with NDM thereby gaining access to the required technologies that are needed for the business. The main reason for the change to take place in the organisation is the poor structure that was involved. According to Wood et al., (2016), a proper organisational structure helps in the smooth progress of an organisation. The employees can do the delegation and reporting of work in a less complicated manner. Due to the poor structure, the performance of the employees working in Truelocal fell drastically. Certain cultural factors were also involved in the organisation. This again led to the adoption of changes in the organisation. Thus, it can be said that the factors that led to the changes, may have a considerable negative effect on the company. As stated by Kempster, Higgs Wuerz, (2014), organisational change needs to take place if the managers feel that certain factors hinder the progress of work. In the case of Truelocal, all three weaknesses of the company contribute to the change in the organisation. Apart from the weakness, the threats that the company received from the competitors and employee turnover also need to be considered. The regular update of technologies poses a challenge for the organisation because it has a huge employee turnover rate. In order to fix this, the managers needed to merge with NDM and relocate to a place that can be easily accessed by the local people. Such changes can provide an opportunity for growth in the region as well as international market.; Benefits and drawbacks of SWOT for change According to Kotler, Dingena Pfoertsch, (2016), organisational change needs to be done based on the internal analysis of the company. In this regard, the use of SWOT analysis can help in understanding the requirements of the organisation and implement changes accordingly. SWOT analysis helps to understand the business in an in-depth manner. The better understanding of the business can help in developing strategies that can be useful for the implementation of changes. It also addresses the weakness of an organisation. Arnold Capella, (2015) stated that the opportunities that a business may have been identified with the help of SWOT analysis. The advantage of the strengths can be used in order to identify the opportunities and address it. Thus, changes in an organisation can take place by analysing these factors. However, certain limitations also exist while implementing SWOT as an analytical technique. Steigenberger, (2015) stated that SWOT analysis does not give priorities to issues. From an objectivist point of view, it is seen that the issues are taken at random and are solved systematically in the order of occurrence. This can cause a risk for the organisation as the more important issues need pose a threat. It also fails to provide an alternative solution after identifying the weakness or treat. The decisions that are needed are to be executed and implemented by the managers. This provides a drawback it is not possible for the managers to come up with appropriate solutions. On the other hand, the social constructionist is of the perception that it does not provide the best solution for solving a problem. Although Chad, (2015) is of the opinion that it provides numerous solutions, managers seek to implement only one solution in order to address the problems. Similarly, it generates information that is not always useful for an organisation. Role of change agent In order to implement changes in an organisation, it is necessary to engage agents that manage the changes (Levasseur, 2013). These agents are referred to as change agents that help in analysing the situation of an organisation and implement the necessary changes. The role of change agents can be described as the following: Investigate: Investigation about the behaviour of the people based on the attitudes and work performance needs to be done before and after implementing the changes. According to Daspit et al., (2017), change agents try to identify clues that suggest the reasons for the prevention of change. These help in eliminating the threats that are hinder the change process. In the case of Truelocal, the change agent needs to determine the steps that are required for removing the obstacles that hinder the change in the organisation. The observation and analytical skills are important for a change agent. Advocate: In order to implement the changes in the organisation, it is necessary that some people voice opinions regarding the implementation of changes. Change agents help in bringing about the voices that support the implementation of changes. This may act as a motivating factor for an organisation in need of serious changes (Bradley, 2016). Truelocal can adopt such practice from any one personnel and ensure that the changes that are implemented in the organisation take quick effect without hindrance. The initiation of change needs to be enforced on a continuous basis in order to maintain focus on the goals of the organisation. Encourage: According to Burke, (2017), changes can only take place if managers and employees are willing to alter the appearances of the organisation. The behaviours, attitudes and activities of the change agents are to ensure that the people in the organisation are encouraged in order to implement changes. This involves taking risks and stepping outside the zone that is not normally in the comfort level of an employee. Truelocal can also implement such encouragement tactics and help in the implementation of changes. It is necessary for the change agent to understand the personal implications of the people and help in motivating the people about the changes required in the organisation. Facilitate: As observed by Clegg, Kornberger Pitsis, (2015), one of the main attributes of a change agent is to analyse ways by which changes can take place in an organisation. This involves formulating strategies and carrying out risks that can be helpful for an organisation. The changes that are to be implemented are analysed and presented in front of the employees in a manner that motivates them to adopt the changes. In the case of Truelocal, this is an important aspect as the agent acting as a facilitator needs to design system and tools that are necessary for the organisation to work in an efficient manner. Mediate: An organisation consists of various groups that provide varied opinions regarding the policies, procedures and strategies adopted by an organisation. Similarly, in terms of changes, these groups provide varied opinions. The role of the change agent in this regard is to act as the mediator. This is required in order to bring about a sense of negotiation between the people and agree on achieving a common goal. Such a role can be attributed as a leader in the business (Northouse, 2015). Advice: In order to build an authority over the people, change agents rely on the expertise they possess. This is done by sharing knowledge that can be useful for an organisation. In the case of Truelocal, the knowledge that is imparted by the change agent signifies the reliability of the people. According to Cummings, Bridgman Brown, (2016), this advice can be given in terms of providing training to the employees or by conducting meetings on a regular basis. In this regard, it can be said that a change agent needs to be confident and knowledgeable. Manage: Another role of a change agent is to ensure that every project undertaken by an organisation has goals, targets and deadlines. This can help in maintaining the pressure required for attaining the goal. One of the drawbacks that can be considered of engaging a change agent is the fact that it holds the people accountable for missing the targets. For an organisation like Truelocal, this can be a risk factor for the organisation. This is mainly because of the rate of employee turnover in the organisation. Hence, the versatile role that a change agent plays need to be analysed by an organisation. Based on the roles, Truelocal has to implement itself in the business market.; Drawbacks and benefits of approaches to change management Certain approaches exist that help in managing changes in an organisation. These approaches are varied from one another and help in the management of change in the company. These include the person-centric approach and the dialogic approach. Person-centric approach- According to Worley Mohrman, (2014), person-centric approach delegates roles and responsibilities in an organisation starting from the higher to a lower authority. Every employee is assigned a particular goal that helps the supervisors and managers to achieve the long-term goal of an organisation. The results that are generated from the application of the person-centred approach helps in the sustainable development of an organisation. In this regard, the application of this approach for implementing the changes in an organisation is critical in order to achieve the desired results. The purpose of change that needs to be implemented in an organisation needs to be shared along with the application of effective leadership. This can help in motivating the employees and encourage them in order to formulate effective change management plans. The potential benefits that can be derived from adopting this approach are the fact that individuals can provide self-opinion about the changes that take place in an organisation (Shirey, 2013). It helps in the formation of small groups and ensures that the employees facing problems can apply themselves in the organisational context. In this case, the role of the change agent is that of a mediator or advisor. The change agent provides advice with the employees and the managers about the advantages and disadvantages of the changes that are taking place in an organisation. New knowledge regarding the organisation or any factor that lead to the change can be acquired by the virtue of these changes. However, there are certain limitations that make it difficult for most organisations to adopt this technique. One such challenge is the setting of a goal. As observed by Cummings Worley, (2014), the employees have to wait in order to set the goals. The person-centred approach follows a hierarchical method. Therefore, it is necessary that the goals of the managers be set on a priority basis. This may take a significant time for an organisation to develop its goals. This is mainly because of the fact that employees can only see the impact of the goals made by the managers. The overall goal of the organisation does not come to the limelight as the managers' focus on achieving the targets that have been given to the employees. It is also done once in a year, therefore despite the change-taking place the goals of the organisation do not change (Longo, 2013). In the light of this analysis, it can be said that in the case of Truelocal, the person-centred approach cannot be implemented. This is mainly because of the fact that the organisation does not have a proper structure. One of the main drawbacks of the organisation that lead to the change in the management is the fact that the organisational structure did not provide comprehensive information about the supervisors. Hence, without the existence of a proper hierarchical structure, it can be difficult for the organisation to maintain the goals and objectives. Dialogic approach- The dialogic approach that is implemented in an organisation is based on the results of the plans, structure of an organisation and implementation of the stakeholders. This normally consists of four phrases that help in the systematic analysis of an organisation. These phrases include exploring and engaging, building and formalizing, implementing and evaluating, developing. These phrases help in the undertaking the demands and requirements of an organisation and help in the successful implementation of change. Burnes Cooke, (2013) stated that the transformational method of change is required to ensure that the change is implemented and accepted in an organisation. The transformational change helps in addressing the dialogic approach in an organisation. In the light of this, certain benefits of the process can be analysed. One such advantage is the fact that it does not rely upon the opinions of the employees. The managers implement the changes and ensure that the employees make proper communication in order to accept the changes. This can be helpful in order to reduce the work of a change agent. The systematic manner in which this method helps in analysing the difference between the old and new method of working motivate the employees in adopting this technique (Burnes, 2017). This helps in changing the attitudes of the workers and assist in bringing about proper change in an organisation. However, certain limitations exist in the approach that makes it reluctant for most organisations to adopt the method. One of the limitations is the fact that without proper motivational technique it may be difficult for the managers to encourage the employees. In this regard, the role of a change agent needs to be that of an encourager. Sudden changes in the organisational context can lead to a high turnover of employees. This, in turn, can hinder the services of the organisation and the implementation of change cannot be affected. Another limitation is the job security of the employees. With a systematic approach to reducing the old method, employees that are backdated cannot implement the new techniques in an effective manner. This provides the threat of job for the employees (Pollack Pollack, 2015). In this regard, the application of such an approach in Truelocal can help in the motivation of employees and reduce turnover rate. The company deals with latest technologies on a regular basis and the changes that need to be implemented have to point to the use of technological advancement. The rate of employee turnover can be reduced with the proper leadership and motivation of employees. Hence, the collaboration with NDM and the relocation of the place can prove to be useful for the organisation. References Booth, S. (2015). Crisis management strategy: Competition and change in modern enterprises. Routledge. Booth, S. (2015). Crisis management strategy: Competition and change in modern enterprises. Routledge. Bradley, G. (2016). Benefit Realisation Management: A practical guide to achieving benefits through change. CRC Press. Burke, W. W. (2017). Organization change: Theory and practice. Sage Publications. Cameron, E. . (2015). Making sense of change management: A complete guide to the models, tools and techniques of organizational change. Kogan Page Publishers. Cameron, E. . (2015). Making sense of change management: A complete guide to the models, tools and techniques of organizational change. Kogan Page Publishers. Clegg, S. R. (2015). Managing and organizations: An introduction to theory and practice. Sage. Cummings, T. G. (2014). Organization development and change. Cengage learning. Farkas, F. (2016). Hard and Soft Approaches of Strategic Organisational Change Management. Strategic management, 13-22. Goetsch, D. L. (n.d.). Quality management for organizational excellence. 2015: Pearson. Goetsch, D. L., Davis, S. B. (2014). Quality management for organizational excellence. Upper Saddle River. New Jersey: Pearson. Hayes, J. (2014). The theory and practice of change management. . Palgrave Macmillan. Hayes, J. (2016). The theory and practice of change management. Palgrave Macmillan. Hechanova, R. M.-O. (2013). Transformational leadership, change management, and commitment to change: A comparison of academic and business organizations. The Asia Pacific, 11-19. Higgs, M. K. (2014). Pilots for Change: Exploring organisational change through distributed leadership. Leadership Organization Development Journal, 85-98. Hornstein, H. (2015). The integration of project management and organizational change management is now a necessity. 291-298. Kotler, P. D. (2016). Driving Change with Strategic Customers. In Transformational Sales. Springer International Publishing. Northouse, P. G. (2015). Leadership: Theory and practice. . Sage publications. Olins, W. (2017). The new guide to identity: How to create and sustain change through managing identity. Routledge. Olins, W. (2017). The new guide to identity: How to create and sustain change through managing identity. Routledge. Olins, W. (2017). The new guide to identity: How to create and sustain change through managing identity. . Routledge. Waddell, D. C. (2013). Organisational change: Development and transformation. Cengage Learning. Wood, J. M. (2016). Organisational behaviour: Core concepts and applications. . John Wiley Sons Australia, Ltd.

Villains free essay sample

This paper describes satanic characters in literature. This essay looks at evil and its corrupting forces in literature, citing Miltons Paradise Lost and Shakespeares Othello. It goes on to discuss the motives of Gandhi and those in the anti-slavery movements, attempting to explain why good will ultimately prevail. From the paper: Both John Milton and Dr. Martin Luther King were clergymen who based their works, writings and speeches on the principles set forth in Christianity. While it might seem to be a difficult task to find a villain in real life who is suitable for comparison to Satan one in whom personal characteristics are so base that they are better seen as completely nonexistent it is not difficult to find such a creature in literature. The character of Lago from Shakespeare?s play, Othello, fits this description well. Not only can Lago be compared to Satan in Milton?s Paradise Lost, but the character of Othello can be compared to an innocent Adam a person who is doing perfectly well before the devil moves in and brings hell with him. We will write a custom essay sample on Villains or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page

Living and Non-Living Cells and Tissues in Trees

Living and Non-Living Cells and Tissues in Trees Only 1 percent of a dormant mature tree is biologically living while the rest is composed of non-living, structural wood cells. In other words, very little of a trees  woody volume is composed of living, metabolizing tissue; rather, the major living and growing portions of a tree are leaves, buds, roots, and a thin film or skin of cells just under the bark called the cambium. There are other living cells that are important for tree growth within the different parts of trees, especially in root tips, the apical meristem, and leaf and flower buds; however, these living cells make up a very small percentage of the total volume of a trees cells. Instead, non-living or dead cells comprise most of the volume of a tree, providing vital structural support for the living cells. Interestingly enough, trees start out in life as a germinating seed with every living cell in hyperdrive, but  as a tree seed becomes a seedling, then a sapling, then a mature tree, its living contents become less and less as a percentage of the total volume. Trees increasingly lose their living cytoplasmic cells as metabolism ceases in each cell, and although they are no longer alive, these non-living cells now provide protection, transportation, and physical support for the living ones. The Vital Role of Non-Living Cells Without the support and structure provided by non-living cells,  trees would likely die  and certainly wouldnt grow quite as large as they do. This is because non-living cells provide a vital role in the process of  how a tree grows  - from the heavy lifting of holding up the tall branches to the trees bark, which protects the thin layer of living cells underneath. This supporting and protective wood is created by cambial-hardened cells produced on the inner and outer cambial layer and sandwiched between the outer cambial layer. As a result, the bark of a tree is a product of the ongoing process of creating  sieve tubes to transport water and nutrients from the leaves to the roots and back. The sound, non-living cells of a tree are very important to helping a tree stay protected, and the bark and structural cells serve as a line of defense against insects and disease that could affect the vulnerable living tissue of the cambium that maintains life throughout the tree. New cells are formed and living cells cease metabolization as they transform into transport vessels and protective skin, creating a cycle of creation, rapid growth, slowing metabolism, and death as the tree climbs ever-higher into a healthy, full plant. When Wood Is Considered Alive and Dead For most intents and purposes, wood is considered to be the product of living cells in trees harnessing the environment around them to make proteins and form protective vessels and shells for the trees sustained growth. Wood is only technically considered dead when its separated from the tree itself, as it still serves a vital role in the plants life when attached to living cells in the tree. In other words, although wood is largely made of non-living cells - cells that no longer reproduce but instead transport nutrients to living cells - it is still considered alive if it is attached to the tree itself. However, if a branch falls off or a person cuts down a tree, the wood is considered dead because it no longer transports living matter through itself. As a result, wood that has been separated from a tree will dry up as the protoplasm hardens and the protein turns into the wood one might use in a fireplace or for building a shelf. This wood is considered dead, though the piece it was once attached to - if still attached to the tree itself - is still considered alive.

Functional Skills for Special Education Students

Functional Skills for Special Education Students Functional skills are those skills a student needs to live independently. An important goal of special education is for our students to gain as much independence and autonomy as possible, whether their disability is emotional, intellectual, physical, or a combination of two or more (multiple) disabilities. Skills are defined as functional as long as the outcome supports the students independence. For some students, those skills may be learning to feed themselves. For other students, it may be learning to use a bus and read a bus schedule. We can separate the functional skills as: Life SkillsFunctional Academic SkillsCommunity-Based Learning SkillsSocial Skills Life Skills The most basic of functional skills are those skills that we usually acquire in the first few years of life: walking, self-feeding, self-toileting, and making simple requests. Students with developmental disabilities, such as Autism Spectrum Disorders, and significant cognitive or multiple disabilities often need to have these skills taught through modeling, breaking them down, and the use of Applied Behavior Analysis. The teaching of life skills also requires that the teacher/practitioner complete appropriate task analyses in order to teach the specific skills. Functional Academic Skills Living independently requires some skills which are considered academic, even if they do not lead to higher education or the completion of a diploma. Those skills include: Math Skills  - The functional math skills include telling time, counting and using money, balancing a checkbook, measurement, and understanding volume. For higher functioning students, math skills will expand to include vocationally oriented skills, such as making change or following a schedule.Language Arts -  Reading begins as recognizing symbols, progressing to reading signs (stop, push), and moves on to reading directions. For many students with disabilities, they may need to have reading texts supported with audio recordings or adults reading. By learning to read a bus schedule, a sign in a bathroom, or directions, a student with disabilities gains independence. Community-Based Learning Skills The skills a student needs to succeed independently in the community often have to be taught in the community. These skills include using public transportation, shopping, making choices in restaurants, and crossing streets at crosswalks. Too often parents, with the desire to protect their disabled children, over-function for their children and unknowingly stand in the way of allowing their children to acquire the skills they need. Social Skills Social skills are usually modeled, but for many students with disabilities, they need to be carefully and consistently taught. In order to function in the community, students need to understand how to interact appropriately with different members of the community, not only family, peers, and teachers.

Orthodox Law Principles Essay Example | Topics and Well Written Essays - 2000 words

Orthodox Law Principles - Essay Example Disguising the employment status could be done in a number of ways. It happens even underwritten contracts where it is common knowledge to both the employee and the employer and could also happen if a worker is hired on a more or less informal basis to provide their labor, and simply assumes or is told that they are a contractor. Mostly there is an interposition of an entity that contracts with the business rather than the worker in his personal capacity. This allows drafting faulty contracts due to the absence of the contractor to review the terms therein provided for (Burne, 23)Businesses sometimes do not register their workers as employees. This benefits both the business and the workers who are treated as self-employed in terms of income tax and insurance remittals. However, the business stands to gain more since it can dismiss workers at will due to the ‘open’ contracts and the employees lack protection and rights. Most businesses will pass that their employees have been contracted for the provision of services and consultancy rather than employment. These are sham contracts. These contracts are chosen by immigrant workers in most countries who are desperate for jobs and do not have proper immigration papers or required skill to seek permanent employment. It is easier for them since they try to avoid the authorities.Many would not find the problem with sham self-employment but it favors the unfettered freedom to engage and dismiss workers as contractors when they are indeed employees.

BUSINESS INTELLIGENCE Tools and Techniques Essay

BUSINESS INTELLIGENCE Tools and Techniques - Essay Example This is a change from the 30 responses required last year. III. There are 13 capabilities described by the author that must be delivered by BI platform. These 13 capabilities can be classified into 3 categories of functionality Integration Information delivery Analysis 1. INTEGRATION BI Infrastructure All tools, interfaces and applications in the platform should have same look and feel. Metadata Management The platform should have the ability to store, search, and capture and reuse the formats, measures, dimensions and report layouts. Development Tools It should provide programmatic development tools and visual development environment to facilitate scheduling, delivering, administering and managing. Collaboration It deals with sharing and discussing information throughout the organization. 2. INFORMATION DELIVERY Reporting It facilitates the reporting procedure by developing formatted and interactive reports in various dimensions (financial, operational, managerial, etc) Dashboards T his is a subset of reporting having the ability to publish web-based reports with interactive tools for display. Ad hoc Query This enables the user to ask their own questions and data queries rather than IT created reports. Microsoft Office Integration Integration with Microsoft tools, formats and formulas is necessary item to be provided. Search-Based BI Application of search index to both structured and unstructured data sources and their mapping enable user to search from (Google-like) interface. 3. ANALYSIS OLAP This enables user to analyze data with extremely fast query and calculation performance making analysis style of ‘slicing and dicing’ possible. Interactive Visualization It includes display of data in a more effective way using charts, tables and other formats. Predictive modeling and Data Mining It helps to classify categorical variables and continuous variables using advance mathematical techniques. Scorecards It implies the use of performance management m ethodology like six sigma and it involves analysis and comparisons. PART B 1. IBM (Cognos) solution has a broad functional footprint and is reporting-centric. It follows ‘information versus an applications agenda’. Information Builders’ WebFOCUS product has a very consumer-centric approach and is found to be as one of the industry's easiest-to-use solutions. It offers integrated search, mobile, use of rich Internet applications and mashups, predictive analytics, data discovery, and visualization but they lack self-service support, ad-hoc analysis, and OLAP capabilities. Microsoft offers low price but they do not provide a road map. MicroStrategy specializes in running deployments on top of large enterprise data warehouses tackling large volumes of data. Oracle offers domain-specific and prepackaged solutions. SAP offers data warehousing, text analytics, on-demand BI, search coupled with BI, metadata, data lineage and impact analysis, and data quality. SAS focuses on forecasting, predictive modeling, and optimization, as well as its investments in data discovery and visualization. QlikTech offers low-cost deployments. Tibco products have unique architecture, combining analytics and interactive

If Dory Had Gone Against Marias Wishes Essay Example for Free

If Dory Had Gone Against Marias Wishes Essay Jack would respond in the affirmative and then, according to Dory, the â€Å"bed would squeak†. Emma wanted to believe that she was living in a fairy-tale and she so she did, refusing to let anyone tell her otherwise. Mrs. Robinson tried to tell Emma that her husband was being unfaithful, and Emma refused to believe. Though Emma had all right not to believe Mrs. Robinson, the fact still remained that Mrs. Robinson was unable to convince Emma of Jack’s infidelity. If Mrs. Robinson could not convince Emma that all was not right in her relationship with her husband, how would Dory, an eight year old girl who did not fully understand the workings of the adult world, be able to convince Emma that Jack was being unfaithful. Emma would have told Dory that she did not understand what she was talking about, and demand to know where she had received her information. When Dory had revealed her source, which she undoubtedly would because of her love for Emma and need to please her, Emma would no doubt have confronted Mrs. Robinson. That confrontation would only have put the altercation between Emma and Mrs. Robinson at a different setting. Emma would still have refused to believe that she was not the only woman in Jack York’s life. Mrs. Robinson would still have set up the â€Å"chance† meeting among Emma, Jack and the lady at the train station. Emma would still have reacted the way she did, and would still have died. It is therefore safe for me to say, that based on my analysis of the short story, Emma, as well as looking at the most likely outcomes for a slight change in the plot of the story, if Dory had told her mother about the lady at the train station, the outcome of the story would have probably been the same.

crime and punishment :: essays research papers

Crime and Punishment consists of many people who have committed distinct crimes, and all of them have served their punishments in one way or another. Raskolnikov was one of the main characters in the novel. Raskolnikov had committed the crime of a premeditated murder. Svidrigailov, on the other hand, did things because they made him feel good. Svidrigailov’s biggest crime was falling in love with Dunya. There are many ways a person can commit crime and there are many ways they can pay the punishment. Raskolnikov’s definition of crime was killing someone and defending himself by thinking that he had done nothing wrong. According to Svidrigailov, crime can be committed by doing something as harmless as falling in love. Some people can pay the punishment for the crime they committed by letting their inner conscience bite them, whereas, some people can make their own life miserable by wishing for something that just wasn’t meant to be. The crime of the rapscallion Raskolnikov also reverberated on a much deeper, moral level inside his own head. Only one of his two murders was actually premeditated, the one committed against Alyona Ivanova. Lizaveta, her tortured sister was an inadvertent death. He was forced to kill her when he failed to shut the door and she was able to come in. He ignored the ultimate rule of good and evil, the principles of justice, and felt that if he killed Alyona no one would be injured because Alyona was a waste to society. Raskolnikov commits his initial crime out of arrogance. "The old hag is nothing.... I killed not a human being," he says. (245) He believed that Alyona was less than a human, and that he was a superior being. Raskolnikov thought that he had a right to kill. Svidrigailov is one of the most enigmatic characters in Crime and Punishment. He employed tacit and devious tactics. Svidrigailov molested, irked, and bothered young women who do not wish to be associated with him. He pandered to their weakness and he self-admittedly used deception to win them for his own. His goal was to pursue Dunya, hence he poisoned his wife, Martha. He wanted to get complete freedom from her. These are the acts of a man who is entirely self-serving. Svidrigailov appeared to believe, almost until the end of the novel, that he could make Dunya love him. When Raskolnikov surrendered, he accepted his mistakes and rejected his self-centered attitude.

Self managed teams

A self-managed team is a group of employees that's responsible and accountable for all or most aspects of producing a product or delivering a service. Self-managing work team effectiveness Is defined as both high performance and employee quality of work life Traditional organizational structures assign tasks to employees depending on their specialist skills or the functional department within which they work. To get work done, many companies organize employees into self-managing teams that are basically left to run themselves with some guidance from an external leader.At Digital, Ayr, management had to learn to step back and let the groups reach their own declslons and In so doing time taken to actually management the organization was Increased. Although a lot of consideration was given to the transltlon it contributed to the success of the approach. Self-managed teams have greater ownership of the tasks they perform and the end product or service they deliver. Self-managed teams ten d to be less costly and more productive than employees working within a traditional hierarchical structure because the team performs both technical and management tasks.Team members may also flll In for each other to cover holidays and absences. Decisions made by self-managed teams are more effective because they're made by the people who know most about the job. A sector in Trinidad and Tobago where self-managed teams can be seen quite often is in the Public Service. Employees in various departments' namely human resources and finance are generally self-managed teams. Employees generally plan and schedule the workflow and manage annual leave and absence, in addition to minor technical tasks.Management and technical responslbllltles are typically rotated among the eam members as career advancement In the clerical stream usually allows for this. Although these teams may be seen as a cohesive self-managed team where there is a sense of trust and respect between team members, in the pu blic service you find overly cohesive teams which leads to â€Å"groupthink†: You usually find team members most if the times conforming with team norms than raise issues that may upset other team members. This leads to reduced effort or stifled innovation.Teams may struggle to make the transition from supervisor-led management to self-management, either ue to lack of Interpersonal skills or poor Implementation of the self-managed team concept within the service. The concept of using groups of cross-functional employees in modern business in the form of a team has been around in the United States for quite some time now. Self-directed teams have been used in Great Britain and Sweden since the 1950's. What both regions have realised or learnt is that particular attention must be placed on development of the teams. Development Is an Important component of self-management.That Includes tralnlng In decision- aking, problem solving, communication and team-building. Team-building e fforts and programs, which take time, energy, and patience, are an essential component of a successful self-managed team. As it relates to how they manage and carry out their tasks self-managed teams are autonomous, although they still require guidance from leaders within the organizational hierarchy. The essential challenge for any team Is to balance empowerment with accountablllty. It must report to that hierarchy Important to note is that using a self-managed team is no solution, nor should it be mbraced as a belief.

Office Automation Essay

Office automation has made office work to be efficient nowadays for the organizations that have adopted the system. Office automation usually refers to a situation where office activities are computerized so that it becomes easier for them to be executed faster and efficiently. This had been facilitated by use of computer in the office and it has really help many companies to cut cost in terms of manpower. Office automation has been relied on by many companies to collect, store, create and transmit office information when they are needed in order to accomplish some basic activities in the office. (Laudon, K. C. and Laudon, J. P, 1994) Our organization has adopted a number of automation and collaboration software to enable them carry on their activities efficiently and to cut cost on wages and salaries. Collaborative software is a system that an organization adopts in order to ensure that the organization is working a coordinated manner when they are executing they office work in their day to day activities. Our organization has not been left in terms of automation as it has implemented some collaborative software to facilitate office activities. Some of the collaborative software that has been adopted by our organization is use of email and instant messaging. The use of email to communicate in our organization has facilitated conveying of messages and data from one point to another either within the organization or even outside the organization. Since the organization adopted the system, it has seen the organization be able to cut cost in term on the cost it incurred previously to send communication via other mode of transmission. However, when it comes to internal communication within the organization, our company has adopted intranet system where employees within the organization uses company mail to send emails to each others only. The use of email in the office has some advantage in that it is the cheapest means of communication, one can forward the mail to another person, one can open the mail from any computer in the world that is connected to the internet, and there is unlimited storage facility. Another advantage of using email to communicate is that the message can be stored in the receiver’s inbox even if he is not in the office. Some of the disadvantages of email are that it might not be used to communicate confidential information; people might misuse the facility and keep on browsing through the internet instead of working. Instant messaging is collaborative software that has been adopted by our organization to communicate within or outside the organization. This facility is very popular in our organization as one get feedback immediately after sending a message to the other person either within or outside the organization. The disadvantage of the facility is that since it requires instant feedback it cannot be used to communicate if the receiver is not there to reply to the message. The facility also cannot be used to communicate detailed information like data and for this case; it needs someone to use another facility. The facility also cannot be used where one want to attach something like a photograph or a map. (Laudon, K. C. and Laudon, J. P, 1994) The collaborative software adopted by our organization has been of great use in our organization to convey messages within and outside the organization. Our company has saved a lot when it adopted the facilities and abandoned the older mean of communication where they used fax or even letters and parcel which are slow and expensive.

Identification of Human Parechovirus in clinical samples Essays

Identification of Human Parechovirus in clinical samples Essays Identification of Human Parechovirus in clinical samples Essay Identification of Human Parechovirus in clinical samples Essay Introduction The viral genus Parechovirus belongs to the household of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of gnawers, were isolated from bank field mouses in Sweden from a patient infected with myocardial inflammation. It portions similarity with Human Parechoviruses. The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to bring forth the diverseness in Parechoviruses. The viruses are 7100 to 8500 bases long which are enclosed in an icosahedral mirid bug made up of 60 transcripts each of mirid bug proteins VP1 to VP4. Once the HPeV1 and HPeV2 were known as echovirus 22 and 23 severally. HPeV2 has 87.9 % aminoacid individuality with HPeV1 genotype. Both were foremost stray in1956 during an epidermic of summer diarrhea. The genome has four distant spheres. The 5 untranslated part ( UTR ) precedes a individual unfastened reading frame, towards downstream there is a 3untranslated part and a poly ( A ) tail. The genome encoding a individual protein is processed by many virus encoded enzymes which produces precursors that map in virus reproduction to bring forth protein eventually. Figure 1: The genome of Picorna virus with conventional representation of poly protein in Parecho virus. The peptide covalently bound to 5end. The perpendicular pointers indicate the virus encoded activities for processing proteins. The places of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein severally ( Beginning: Stanway, G.et Al ( 1999 ) Parechoviruses.Journal of Virology, 73, 5249-5254 ) . In general, all Picorna viruses have same basic genomic organisation, but different genotypes show specific features in 5UTR construction, L and 2Aproteins and 3UTR. There exists similarity in 5UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the development of parechoviruses. ( Stanway, G. et Al, ( 1998 ) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650 ) The Parechovirus shows assorted responses in host cells. The cleavage of mirid bug protein VP0 seen in other Picorna viruses are non found in Parechovirus. It has a alone extension at N-terminal of mirid bug protein, VP3 and 2A protein which is extremely basic in character. ( Stanway, G. et Al, ( 2000 ) Human parechoviruses- biological science and clinical significance, Reviews in Medical Virology,10,57-69. ) Many recent surveies shown that the Parechoviruses are holding high rate of pathogenicity which causes stomach flu, respiratory unwellness, feverish unwellness, skin eruption, manus, pes and oral cavity disease , sterile meningitis, herpangia. The more prevalence of Parechovirus infections are found in kids less than 3 old ages. Harmonizing to a research done by Miyabi Ito.et Al on clinical stool samples from a random population in Aichi, Japan suggests that the base and aminoacid sequence of Nipponese HPeV-3 was similar to that found in Canada and Netherlands. The survey confirms the world-wide prevalence of Human Parechovirus infection. Besides they concluded that 97 % of patients were younger than 3 old ages old, and among them 86.2 % were under 12 months old. The finding of nucleotide sequence and phyletic analysis of VP1 part and 5UTR part revealed that bulk were holding HPeV1 infection, so comes HPeV3, so HPeV4 and eventually less figure with HPeV6. They besides found some seasonal fluctuation act uponing the clinical manifestation of Parechovirus. HPeV1 detected preponderantly during autumn and winter while HPeV3 instances detected in summer and autumn. They came to a decision that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. ( Miyabi Ito et Al ( 2010 ) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688 ) Based on the survey of the antigenic belongingss of human Parechoviruses done by Paivi Joki Korpela. et Al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal part. The immunological features of HPeV1 mirid bug protein was besides found out utilizing the peptide scanning techniques. ( Korpela, P.J et Al ( 2000 ) Antigenic belongingss of human parechovirus1, Journal of General Virology, 81, 1709-1718 ) Surveies reveal that HPeV infects the cardinal nervous system ( CNS ) in kids associated with terrible neonatal sepsis like unwellness, meningitis or palsy. A group of scientists under the counsel of S.Rangraj has done surveies on HPeV-CNS infection in United States. This was the first multiyear prevalence study of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of kids around the Kansas City for 3 old ages 2006 to 2008. HPeV RT-PCR was used and surveies done by sequencing VP3/VP1 junction. They could observe the HPeV in 7 % cerebrospinal fluid samples taken from patients, and the sensing was seasonal from June to October. HPeV3-CNS infection was found in 71 % of male babies. Most common clinical symptoms were sepsis like unwellness ( 66 % ) , crossness ( 98 % ) , fever ( 95 % ) and non-specific roseolas ( 58.6 % ) . ( Rangaraj.S et al ( 2010 ) Human parechovirus3 doing sepsis like unwellness in kids from Midwestern United States, The Ped iatric Infections Disease Journal, www.journals.iww.com ) The prevalence of world-wide pathogenesis shown by Parechovirus is obviously proved by Pham et al by making the research in 362 fecal samples for the sensing of HPeV types in one twelvemonth 2005 to 2006. They have done the survey in many kids who got infected with stomach flu in Srilanka. Out of 362 samples, 30 were positive with HPeV ( 8.3 % ) .The genotypes isolated were HPeV1, 3,4,5,10,11. ( Pham.N.T.K et al ( 2010 ) Human Parechovirus infection in kids hospitalized with acute stomach flu in Srilanka, Journal of clinical microbiology, www.mdlinx.com ) . The viral RNA reproduction composite in HPeV1 septic cells would incorporate the viral protein and membrane changes. The structural alterations in virus septic cells include the Golgi setup decomposition and loss of ribosomes from endoplasmic Reticulum. The viral plus strand RNA and 2C viral proteins were found as bunchs of little cysts in cells. The membrane adhering belongingss of protein 2C resulted in the determination of its presence in Golgi setup and endoplasmic Reticulum. HPeV1 reproduction composite is formed by Golgi marker cysts forms a alone construction among other Picorna viruses. ( Krogerus.C et.al ( 2003 ) Replication composite of human Parechovirus 1, Journal of Virology, 77, 8512-8523 ) In this survey, the clinical sample from a kid with mild diarrhea is taken which is analysed utilizing assorted molecular techniques, in peculiar RT-PCR. The survey included the sensing and analysis of viral RNA, surmising it as HPeV by naming the particular symptoms shown by the patient. The RT-PCR is done by utilizing HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations utilizing Gene service.T7 and SP6 RNA polymerase written text induction sites of pGEM ( R ) -T Easy vector is used for this intent. The Analysis of DNA sequence is done farther utilizing Bioinformatics tools. It offers a speedy method of observing Parechovirus and placing which of its genotype is present in the clinical sample. Materials and Methods All the molecular methods were done on the footing of protocol given in Stanway, G. ( 2009 ) Practical Handbook. The RNA being isolated from the clinical sample utilizing commercial kit, QIA A ( R ) viral RNA mini kit produced by Qiagen. The kit works on the rule of selective binding belongingss of silicon oxide gel. ( hypertext transfer protocol: //www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp ) . The RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . Two primers OL993A and OL994A were used that are complimentary to the 3end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by utilizing the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective home bases incorporating Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 limitation digestion. The sample was so commercially sequenced utilizing Geneservice. The analysis of DNA sequence has been done with Blast plan ( hypertext transfer protocol: //www.ncbi.nlm.nih.gov/BLAST ) and alignment with Clustalw plan ( hypertext transfer protocol: //www.ebi.ac.uk/tools/clustalw/index.html ) . ( Stanway, G. ( 2009 ) BS934 Practical Handbook- Molecular Medicine Pathway ) Consequence Isolation of RNA from clinical sample: RNA set Deoxyribonucleic acid marker set Figure 2: The Agarose gel cataphoresis exposure of stray RNA sample. The RNA was isolated utilizing Qiagen viral RNA isolation kit. The cataphoresis was done along with DNA marker ( 1kb ladder supplied by Invitrogen ) and visualized the RNA set utilizing gel certification equipment. The RNA stuff was seen as a vilification on the Agarose gel. RT-PCR Deoxyribonucleic acid: Negative Control RT-PCR merchandise Deoxyribonucleic acid Marker Figure 3: The exposure of Ethidium bromide stained RT-PCR DNA after Agarose gel cataphoresis. As per the protocol given in Stanway, G. ( 2009 ) Practical Handbook, the RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . It is found out that the RT-PCR DNA set has been visualised utilizing gel certification equipment. The presence of set confirmed the presence of HPeV in the clinical sample. There was no set seen in the negative control demoing the echt consequence without any kind of taint. The approximative size of the merchandise is obtained by comparing with the 1kb size criterion DNA marker set. RT-PCR calibrated secret plan for finding the molecular weight of DNA sample: Distance migrated by unknown DNA sample= 37mm Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel cataphoresis. The unknown molecular weight of the RT-PCR sample is calculated from the graph ( fig: 4 ) which was migrated to a distance of 37mm was found to be about 1000 bp ( reverse log 3 ) . Final gel consequence: 1 2 3 4 Figure5: The Agarose gel exposure obtained in 2010 practical. In the fig: 5, the sets were obtained for the RT-PCR DNA and EcoR1cut DNA from white settlement ( Lane 2 and 4 severally ) . There was no set formed for the EcoR1 cut DNA from the blue settlement ( Lane 3 ) . Deoxyribonucleic acid marker RT-PCR Deoxyribonucleic acid from white settlement EcoR1 cut DNA from bluish settlement EcoR1 cut DNA from white settlement Figure 6: The Agarose gel exposure from 2009 practical for comparative survey. The set formed by EcoR1 cut DNA from bluish settlement can be seen. Multiple sequence alliance of DNA sample utilizing Clustalw plan: HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59 HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59 Consensus -GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57 HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59 HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59 HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59 HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59 HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59 HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59 ** ** * ** ** ** * * * ** *** * ** * ** ** HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119 HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119 Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117 HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119 HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119 HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119 HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119 HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119 HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119 ** ** ** ***** ** * ** ** ** ***** ** * ** ** * * HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179 HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179 Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177 HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179 HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179 HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179 HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179 HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179 HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179 * **** ** ** ** ** * ** ** ** ** ** ** * ***** * ** HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239 HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239 Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237 HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239 HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239 HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239 HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239 HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239 HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239 **** ** * * * * *** * ** HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299 HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299 Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297 HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299 HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299 HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299 HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299 HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299 HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299 ** * ** ** ** * * * ** * ** * * ** ** * ** HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359 HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359 Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357 HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359 HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359 HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359 HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359 HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359 HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359 * *** * * * * ** ** * * ** ** * ****** HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419 HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419 Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417 HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419 HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419 HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419 HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419 HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419 HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419 * * * ** * ** * ** ** * ** ** ** ** HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479 HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479 Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477 HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479 HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479 HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479 HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479 HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479 HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479 ** *** * * ** * ** * ** ** * ** * * ** * * HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539 HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539 Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537 HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539 HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539 HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539 HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539 HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539 HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539 * ** * * ** ** * ** ** * HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599 HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599 Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597 HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599 HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599 HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599 HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599 HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599 HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599 ** * * * ** * ** ** ** ** * ** ** ** ** ** ** * HPeV1 TAC -G -AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647 HPeV6 CACACCACGCTCG -CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656 Consensus AAC -A -ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645 HPeV4 TGC -A -ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647 HPeV5 GAA -A -ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647 HPeV2 AGC -AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644 HPeV7 AATTAATACTACA -CCAATAGGC -TACAGTAACGAAAGCCCATATGGTCAAGAACA 653 HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG -AAGCACC 656 HPeV3 AACTGGTTCAAGG GCTACAGCAC TTTCTGATGAG 633 ** HPeV1 G 648 HPeV6 G 657 Consensus HPeV4 G 648 HPeV5 G 648 HPeV2 A 645 HPeV7 AGTGACAAC 662 HPeV8 AAT 659 HPeV3 Discussion: I have started the experiment with an premise of HPeV virus infected the kid demoing mild diarrhea. The isolation of viral genome from the clinical sample utilizing Qiagen kit ( rule: selective binding belongingss of silicon oxide gel ) and Agarose gel cataphoresis proved that the viral genome was RNA. From analyzing the Agarose gel photographic image it clearly showed that the RNA isolation was successful ( Fig: 2 ) . From the gel photographic image of RT-PCR ( Fig:3 ) , we can presume that the PCR merchandise DNA is holding a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel ( Fig:4 ) , I could turn out the approximate molecular weight of DNA sample after PCR which is closer to the false value got from gel cataphoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to magnify under specific thermic rhythms. The absence of set in the negative control shows the RT- PCR done was right without any taint. The RT-PCR has helped to uncover speedy DNA elaboration which is advantageous over traditional PCR. It besides collects informations in the exponential growing stage whereas traditional PCR is measured at the terminal point. The cloning of PCR merchandise done utilizing pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase boosters. A group of scientist under Smeekens.S.P has done their survey on T7 booster sequence. T7 RNA polymerase which has specific adhering belongingss with T7 boosters determines the reproduction of bacteriophage. The booster specific binding was shown to be insensitive to fluctuation in the ionic strength of incubation solution but found sensitive to DNA spiral. The efficiency of polymerase-promoter unfastened composites are determination factors of written text. ( Smeekens.S.P et.al ( 1986 ) Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford diary on Nucleic acids Research,14,2811-2827 ) The chief intent of utilizing the pGEM R -T easy vector is that, it is holding multiple cloning parts. It has ampicillin opposition cistron which would do the host cell to last in Principen rich medium. There are EcoR1 limitation enzyme acknowledgment sites on both sides of ligated RT-PCR merchandise in the vector. Thus the plasmid isolation after the Transformation is done utilizing EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR merchandise into vector. The Deoxyribonucleic acid with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to do it competent utilizing CaCl2. If the whole procedure was successful we would hold got bluish and white settlements of cloned cells in the LB stock home bases. But the bluish settlements were non able to separate decently in the thick of other ampicillin sensitive settlements. The ground for the complete growing of unwanted settlements might be due to the low concentration of Ampicillin added as experimental mistake. Thus the Principen sensitive cells besides multiplied along with cells incorporating vector and cistron of involvement. As a consequence there was no set produced in the Agarose gel cataphoresis from the bluish settlement cells. The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The Deoxyribonucleic acid sequence is analysed utilizing the package plan. The finding of direct or indirect orientation of DNA sequence is done utilizing Blast nucleotide hunts. The T7 belonged to human parechovirus1 ( length7380 ) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 ( length 7380 ) was found to be indirect with +/- strands. The contrary compliment for SP6 was taken and the alliance done utilizing Clustalw. Then with different HPeV type sequences the consensus sequences are compared utilizing Clustalw. By analyzing the sequences and phyletic tree the sequence isolated from clinical sample has similar hereditary beginning with HPeV1 type Parechovirus. Hence it is identified that the kid is infected with Parechovirus type1 infection. Recognition: I would wish to widen my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and counsel for my practical work. I am besides widening my thanks to Ms. Maysoon, PhD pupil for her support during the practical work.

Endosymbiotic Theory

Endosymbiotic Theory The endosymbiotic theory is the accepted mechanism for how eukaryotic cells evolved from prokaryotic cells. First published by Lynn Margulis in the late 1960s, the Endosymbiont Theory proposed that the main organelles of the eukaryotic cell were actually primitive prokaryotic cells that had been engulfed by a different, bigger prokaryotic cell. The term endosymbiosis means to cooperate inside. Whether the larger cell provided protection for the smaller cells, or the smaller cells provided energy to the larger cell, this arrangement seemed to be mutually beneficial to all of the prokaryotes. While this sounded like a far-fetched idea at first, the data to back it up is undeniable. The organelles that seemed to have been their own cells include the mitochondria and, in photosynthetic cells, the chloroplast. Both of these organelles have their own DNA and their own ribosomes that do not match the rest of the cell. This indicates that they could survive and reproduce on their own. In fact, the DNA in the chloroplast is very similar to photosynthetic bacteria called cyanobacteria. The DNA in the mitochondria is most like that of the bacteria that causes typhus. Before these prokaryotes were able to undergo endosymbiosis, they first most likely had to become colonial organisms. Colonial organisms are groups of prokaryotic, single-celled organisms that live in close proximity to other single-celled prokaryotes. Even though the individual single-celled organisms remained separate and could survive independently, there was some sort of advantage to living close to other prokaryotes. Whether this was a function of protection or a way to get more energy, colonialism has to be beneficial in some manner for all of the prokaryotes involved in the colony. Once these single-celled living things were within close enough proximity to one another, they took their symbiotic relationship one step further. The larger unicellular organism engulfed other, smaller, single-celled organisms. At that point, they were no longer independent colonial organisms but instead were one large cell. When the larger cell that had engulfed the smaller cells went to divide, copies of the smaller prokaryotes inside were made and passed down to the daughter cells. Eventually, the smaller prokaryotes that had been engulfed adapted and evolved into some of the organelles we know of today in eukaryotic cells like the mitochondria and chloroplasts. Other organelles eventually arose from these first organelles, including the nucleus where the DNA in a eukaryote is housed, the endoplasmic reticulum and the Golgi Apparatus. In the modern eukaryotic cell, these parts are known as membrane-bound organelles. They still do not appear in prokaryotic cells like bacteria and archaea but are present in all organisms classified under the Eukarya domain.

Apple case study Essay Example | Topics and Well Written Essays - 2500 words

Apple case study - Essay Example Part 1. External Analysis The business environment for Apple Incorporated has become so challenging considering that there are important components in it that needs to be understood in detail. PESTEL Analysis In every business environment, government is an essential component for a successful business implementation. Porter believed that the government has important role to play when it comes to the establishment of a harmonious business environment for every business or industry. Thus, there is no wonder why political consideration has always been an important concern in every business situation. In the case of Apple Incorporated, it is crucial with its business to maintain its identity and this is done through intellectual property management for the designs of its product offerings. In line with this, the government always has political power to include in its policy and procedure for handling business situations. It is also in line with this that there is a higher level of associ ation involved with legal concerns. The legality is necessary because it is through this that a business or organisation can successfully implement the right strategy and procedure. The economic recession in the United States which has affected the entire world economy has also created a chain impact on Apple Incorporated’s financial performance. ... In the case of marketing activity, people are socially aware that it is a matter of idea that can substantially influence their buying power. In line with this, Apple Incorporated considers the most important idea that can create social impacts. The cutting-edge technology of Apple Incorporated can substantially compete with the ongoing trend. This is due to the fact that advancement of technology has become tantamount to the level of progress in everywhere. The corporate social responsibility is one of the latest trends in business. This is due to the fact that there is a need to consider the environment. In fact, businesses are highly influenced by the fact that there is a need to be environmentally concerned and not just purely on making profits. Porter’s Five Forces Porter’s five forces model can substantially explain how competitive rivalry between Apple Incorporated and other manufacturing companies in its industry is formed. Samsung, Nokia and other rivals of App le Incorporated have substantially created specific strategic moves in the market. Considering that these companies are also good at creating demand for their product offerings. Apple Incorporated has been faced by issues concerning the design of its offerings. These companies have essentially copied in detail what Apple has viewed to be remarkably important for its customers. These companies have learned the information that customers are looking forward not only on brand quality but reliability issues and utility issues. Thus, customers have strong market power because of increasing models of product offerings. Competition has become so intense which resulted to Apple’s highly differentiated strategy of stimulating needs for

Role of the Man in the Family Research Paper Example | Topics and Well Written Essays - 750 words

Role of the Man in the Family - Research Paper Example A man is an extremely crucial member of the family, and his roles are exceptionally crucial for smooth functioning and success of the family. Different families and cultures assign different roles to men, but there are universal men’s roles that are widely accepted in all cultures and families. Men’s roles range for love, protection, decision-making, family support, provision, fatherhood, husband, teaching and family security, (Bronstein and Carolyn 344). Men as the family heads preside over crucial family matters and issues that affect the well-being of the family. He is responsible for making key decisions in the family, for instance, decisions concerning the family property such as land acquisition, disposal, allocation between family members (children) and family development. Men are wage earners and providers of the needs and requirements of the family. A man should ensure sufficient supply of family basic needs and other means of supporting the unit economically and financially. He should contribute to physical, psychological, emotional support and mental support of the unit. In a bid to achieve this, he should reorganize his available resources to cater for his family needs, (Brody 234). A man as a protector means that he should ensure both physical and emotional security of his family. It implies safeguarding his self-esteem and worth and the self-worth and esteem of his family members. It may also imply safeguarding his ways of livelihood and protecting his family against any external and internal threat, for instance, threat to family property, value, reputation and family members. A man as leaders should lead and direct all the programs and projects of the family. For instance, instead of sitting back and watch his spouse takes initiative in case of a challenge he should take the lead. He should participate in the game and establish what he desires in his family rather than whining about his

Technology as Fast and Slow Knowledge Essay Example | Topics and Well Written Essays - 750 words

Technology as Fast and Slow Knowledge - Essay Example On the one hand, he is right to say that technology ruined the environment because of overproduction and industrialization. On the other hand, he does not consider how technology can also help promote ecological interests by developing slow knowledge. This paper argues that although technology has produced harmful effects on ecology, it can also be used in studying and resolving environmental problems through providing fast and slow knowledge. As stated above, Spayde contends that a gap exists between what people have (technology) and their capabilities in properly using it (ethics or moral development). Spayde argues that slow knowledge that is based on â€Å"ecological and cultural context† is better than â€Å"fast knowledge† that â€Å"zips through the terminals of information society† (68). He proves this by saying that fast knowledge provides technology, but this technology has no sense of morality and collectiveness. He also differentiates hard facts from having the slow knowledge or ethics in properly using facts. ... This essay will prove that these contentions on the balanced outlook on fast and slow knowledge and the importance of technology in ecology are correct through evidence and logic. Technology, especially through computing, has significantly helped the development of the study of ecology. In Chapter 24: Roles of Technology in Ecology, Klomp, Green, and Fry explore the role of technology in advancing environmental interests. They stress that computing technology has expanded the spatial reach of ecological studies through the use of remote sensing and related methods. They underscore that computers have eased the use of large data sets and sophisticated statistical packages and also enabled access to and accumulation of national and global data sets. Klomp, Green, and Fry add that using computer-generated models help simulate environmental events, can offer a greater understanding of ecosystems, and enhance predictive powers to conservation and land managers. Hence, technology can also be used as a tool in addressing environmental problems. Technology does not only produce fast knowledge, like what Spayde contents, because its fast knowledge can also be used to produce slow knowledge. Computer modeling, for instance, has affected ecological theory. Klomp, Green, and Fry explain that ecosystem connectivity is an illustration of a complex ecological problem that computer modeling has handled with substantial success. They underscore that computers have enabled simulations of experiments that real time or space would not otherwise permit. This fast knowledge produced slow knowledge that allowed the development of landscape ecology. Klomp, Green, and Fry argue that computer simulation of this complexity has helped ecologists to better

Sexism In Womens Professional Sports Media Essay

Sexism In Womens Professional Sports Media Essay Sexism is the belief or mind-set that one sex (usually the male) is innately superior to, more skilled, or more worthy than the other is. It includes all kinds of prejudice, overt or covert, concerning gender. It is the belief that a certain gender is inherently better than the other; therefore, it should be in charge of the most significant spheres of political, financial, and social life. It principally involves detestation of, or bigotry towards whichever gender as a whole or the appliance of stereotypes of masculinity to all men, of femininity to women. Sexism is also known as male and female chauvinism. Sexism has been narrowed down to be described as the practice of dominance of men over women. Sexism is a practice that is held up in various ways such as through language, visual links, media depiction, and stereotyping, particularly based on the maternal/caring role of women. These ways are significant to our socialization into our gender roles, and as a result, it makes this d ominance tolerable in the community. Sexism is such a significant issue because all women go through it in various ways. For example, in the workplace and at home depending on their economic and social situation; it restricts the ways in which women go about actualizing their potential. The Sports organizations are not free from sexism either. This controversy is not a new issue that has risen. Sexism in sports goes as back as sports and sexism itself goes. Sexism in sports dates back to back to B.C.s. Even from as long as 776 B.C., antique Greek prohibited women as contenders and audience from the Olympic Games. Any married woman who was found around the stadium was thrown from a cliff (Borish, 1996). In August 1890, W.S. Franklin declared the creation of a womens professional baseball league. It was required that for one to take part in the league, they must be aged below 21 years, beautiful, and have a gorgeous shape. This was a step forward but was still not sufficient for the women. In the 1900 Olympics edition, in Paris France, was made up of 1308 men and only 11 women, another positive step from primeval Greeks but still not sufficient. Prior to 1916, women were not permitted to attend boxing matches since the sport was viewed to be too violent for the women. In the 1920 Olympics, the judges warned American figure skater Theresa Weld for making jumps that they deemed not lady-like. Before that, it was worse with jumping itself being deemed unlady-like. In early bobsled contests, two of the riders had to be women; however, they were not allowed to drive nor work the bakes. In the 1928 Olympic 800-yard running event, a number of women collapsed, this provoked the then IOC president Compete de Baillet-Latour to attempt to free the games of all womens track contest. In 1936, Avery Brundige, the then chief of the US Olympic Committee remarked, that he was sickened to the ears by women who wanted to participate both as field and track competitors. According to Brundige, they do not have any charm although they are adroit and beautiful, they cannot perform not in the swimming or diving category (Danziger, 1999). He went on to become the chief of the international Olympic committee in 1952. Women track competition longer than 200 meters were ba nned until 1960 when the 800-meter race was re-established. Women were also not permitted at center court for the Italian championship tennis finals before late 1960s. In 1972, the 1500 meters track competition was introduced in the Olympic sports. The womens AAA in the UK barred women from taking part in long-distance road races prior to 1975 when they were allowed. The International Olympic committee declined to allow women to take part in the 3000 meters track event for the 1980 Olympics in Moscow in the USSR, since the event was considered a bit too arduous for women. In the subsequent Olympics games in1984 the 3000 meters race alongside the marathon was added. In 1997, in the US, a womens professional basketball league was started, the Womens National Basketball Association (WNBA). As evidenced by this account, it has it has been a protracted and sluggish battle for women in sports. Sexism was deeply rooted in sports, and the fight against it has truly advanced through the years. On a positive note, however, there is far less offensive and overtly sexist handling of women athletes than it was the situation two or even one decade ago. Undoubtedly, there has been a gender revolt in American sports in recent times (Hargreaves, 2000). Millions of girls participate in sport competitions daily be it in college or professional leagues. Womens athletic ability levels have also done up astronomically over the last two decades in sports ranging from basketball to volleyball, from hockey to soccer etc. There still exists a long and hard journey to go for women athletes to attain the same opportunities and hold up as their male counterparts. Although discrimination of people based on their gender has almost ended in regards to whether sports bodies allow women to participate in some sports games, more need to be done to improve the way sports commentators and the general population characteristically speak of women athletes. The media and sponsors are also guilty of prop agating sexism in sports. For example, the overall coverage of womens sports has gone down to ridiculously low levels. It is time for the news media and the sports shows to up the tempo to be able to keep pace with this revolution. It is a fact that women in professional sports have never been entirely supported, either fiscally (by sponsors) or psychologically (by the media and the fans). Women have tried hard to get reorganization and respected by governing bodies. The media and public need to change their sexist outlook; this will enable sexism in sports to be wiped out. Just this year, two leading British soccer radio commentators, were relieved of their jobs a day after being taken off the air for making sexist remarks about a female assistant match official during the English premier league duel between Wolves and Liverpool. The duo requeted that a person should go to the field to show the dumb women what was meant by the offside rule. Women do not know what it is, asserted one. Certainly not, the second one concurred. Britains Sky Sports, Richard Keys, and Andy Gray were criticizing the work of the linesman Sian Massey, and they were aware that they were on air. Then as if that was not sexist enough, they laughed about the policy of West Ham United concerning sexism in football. Keys and Gray asked each other rhetorical remarks that were aimed at lowering the morale of Karen and never thought of what she would feel. Now this could be disguised as humor; however, it is also true that jokes at a persons race, or gender expense are a mask of anger t o that persons race, or gender. The words of sports commentators and sports shows hosts, repeated many times by different commentators in the same or similar manner, just like propaganda, provide a theoretical frame for the sports experience. This abstract frame is of interest since the fans often relate it even to non-athletic situations. In Wimbledon, it is a widely known that the scheduling of women tennis at the central court is mostly based on looks rather than prowess. In fact, the reason why female tennis is so popular has everything to do with the sex appeal of the female players and little (if at all anything) to do with their ability to play tennis (not to say they are not good players but to say their abilities are ignored). Marketers of female tennis sell its sex appeal rather than the skill of the athletes. Furthermore, it is an open secret that the world over, more importance is attached to men sports. Media coverage in general is better for male leagues and tournaments than female ones. Even the cost of courtside tickets for NBA vis-Ã  -vis that of the WNBA points to this. It costs more to attend NBA matches that WNBA matches. This is a testament to the fact that more value is attached to mens sports. The media, as an institution, is guilty of perpetuating sexism in tennis and sports in general. Media gives more emphasis on male sports compared to female sports. This, they claim, is because more men attracted to sports than women are. This is not true, and the assertion is contradicted by facts. Nationwide statistics point toward the fact that women make up to 38% to 42% of all sport and physical activity contestants. Nonetheless, study indicates that female sports get roughly 6% to 8% of the entirety sports coverage. According to the Amateur Athletic Foundation of Los Angeles (2000), the main factor that plays a part in deciding what sports gets coverage in newspapers is the interests of the editor; the number of sports covered grew when the ability of women in sports was devalued. The media also perpetuate sexism in sports by depicting female athletes as feminine and sexually attractive. From a traditional perspective, it is easy to say there is nothing wrong with portraying wom en in general as attractive. However, female athletes surely warrant equal acknowledgment for their sporting capabilities as male athletes. When a female athlete appears in a sport periodical or an ad to market in a sport she ought to be portrayed with respect as is male athletes, an accomplished athlete. Another problem for depicting sexual images of female athletes is the fact that images are very influential and form as well as mirror attitudes and values (Birrell and Cole, 1994). Depicting female athletes as sexual beings, or pretty sends the message that they are not greatly skilled as athletes. Depictions that overlook or belittle females athletic abilities dent the significance of womens sports and esteem for the skills of sportswomen (Fields, 2005). The use of sexist imagery to sell female sports by advertisers, promoters, and the media in general sells the athletes not as so, but as sex objects. Instead of fans going to matches to see the sporting prowess of the contestants , they go there to see the pretty ladies, they were promised in the promotions. The media and the promoters might argue that the selling of sexy images of females in general works. Of course, if it did not work they would not do it. The underlying argument would be that this is what their target market wants. This argument would be an astonishing insensitivity to the detrimental results of sexism. The sports media and the advertising industry have a responsibility of not perpetuating destructive and restrictive images to the society. The same This is what the target market wants and, This is what works or sells would not be acceptable if the images portrayed are racist or anti-Semitic. The fact that pornography sells and might be what they want to consumers does not make it any more acceptable. This argument is obviously unacceptable.